Your DNA is 99% or more similar to our DNA whereas our DNA is very similar to any person on this planet, there is so much difference between you and us. There is only a difference of one percent or less. This one percent determines your uniqueness.
The question is, how do we match the DNA evidence in the forensic test?
More than 99% of our DNA is similar to each other, which means that 99% of the DNA that makes up our organs is identical, whereas 99% of the DNA does not convert into any kind of information.
There are tens of millions of DNA characters that do not translate into any kind of superficiality but they are present inside us and are completely different from other people.
We call it polymorphism in technical language. These changes take place inside every person and there are many areas on our chromosomes where these changes take place frequently. We call them tandem repeats.
In forensic we look at these polymorphisms and tandem repetitions and use it to create a forensic profile of the offender as if there is a code that GATAGATAGATAGATAGATAGATA is now coming in this code frequently then it will first be found in the offender's chromosomes, and then they make a profile out of it and match that profile with the evidence to prove the crime.
Only hairs or semen samples are sufficient for this purpose at the next event or can be made by extracting DNA from a blood sample.
These changing codes are different and unique from parents to each person, so we can use DNA testing to find out who is a relative and who has committed a crime.
In the same way, despite the difference of only one percent, the chances of having a child with the same DNA as you are can be increased after giving birth to thirteen trillion children.
